Transcript: Human XM_011513664.3

PREDICTED: Homo sapiens TBC1 domain family member 1 (TBC1D1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D1 (23216)
Length:
5920
CDS:
359..4084

Additional Resources:

NCBI RefSeq record:
XM_011513664.3
NBCI Gene record:
TBC1D1 (23216)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513664.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311163 TATCGGCCAGACATGATTATT pLKO_005 3353 CDS 100% 15.000 10.500 N Tbc1d1 n/a
2 TRCN0000183075 CAAAGGAAACTTATGAGGTAT pLKO.1 2273 CDS 100% 4.950 3.465 N TBC1D1 n/a
3 TRCN0000349583 CAAAGGAAACTTATGAGGTAT pLKO_005 2273 CDS 100% 4.950 3.465 N TBC1D1 n/a
4 TRCN0000146736 CCTAGAAACCATAGTTGACTT pLKO.1 3631 CDS 100% 4.950 3.465 N TBC1D1 n/a
5 TRCN0000318877 CCTAGAAACCATAGTTGACTT pLKO_005 3631 CDS 100% 4.950 3.465 N TBC1D1 n/a
6 TRCN0000182887 CGCTAAACAGTTACAAGCTTA pLKO.1 3727 CDS 100% 4.950 3.465 N TBC1D1 n/a
7 TRCN0000147638 GATCTCCTTTAGAACCAGTTT pLKO.1 2658 CDS 100% 4.950 3.465 N TBC1D1 n/a
8 TRCN0000318876 GATCTCCTTTAGAACCAGTTT pLKO_005 2658 CDS 100% 4.950 3.465 N TBC1D1 n/a
9 TRCN0000147724 GTGACAACCAAAGAATGGATA pLKO.1 3801 CDS 100% 4.950 3.465 N TBC1D1 n/a
10 TRCN0000318878 GTGACAACCAAAGAATGGATA pLKO_005 3801 CDS 100% 4.950 3.465 N TBC1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513664.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.