Transcript: Human XM_011513769.2

PREDICTED: Homo sapiens PPARG coactivator 1 alpha (PPARGC1A), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPARGC1A (10891)
Length:
2404
CDS:
95..2137

Additional Resources:

NCBI RefSeq record:
XM_011513769.2
NBCI Gene record:
PPARGC1A (10891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364084 GACTATTGCCAGTCAATTAAT pLKO_005 1262 CDS 100% 15.000 21.000 N PPARGC1A n/a
2 TRCN0000364085 TATGACAGCTACGAGGAATAT pLKO_005 2009 CDS 100% 13.200 18.480 N PPARGC1A n/a
3 TRCN0000001168 CGACTTGGATACAGACAGCTT pLKO.1 241 CDS 100% 2.640 2.112 N PPARGC1A n/a
4 TRCN0000364086 TCGTGTTCCCGATCACCATAT pLKO_005 1838 CDS 100% 10.800 7.560 N PPARGC1A n/a
5 TRCN0000095313 CCCATTTGAGAACAAGACTAT pLKO.1 928 CDS 100% 4.950 3.465 N Ppargc1a n/a
6 TRCN0000001169 GACAGCGAAGATGAAAGTGAT pLKO.1 1646 CDS 100% 4.950 3.465 N PPARGC1A n/a
7 TRCN0000001167 CCTCCTCATAAAGCCAACCAA pLKO.1 1007 CDS 100% 3.000 2.100 N PPARGC1A n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2237 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.