Transcript: Human XM_011513772.1

PREDICTED: Homo sapiens C1q and TNF related 7 (C1QTNF7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C1QTNF7 (114905)
Length:
4390
CDS:
130..1020

Additional Resources:

NCBI RefSeq record:
XM_011513772.1
NBCI Gene record:
C1QTNF7 (114905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159116 GCGCTGAATCAGATTTAATAA pLKO.1 1580 3UTR 100% 15.000 21.000 N C1QTNF7 n/a
2 TRCN0000371573 CAATTCTCGAAAGGCTATATA pLKO_005 1406 3UTR 100% 15.000 10.500 N C1QTNF7 n/a
3 TRCN0000371636 TGATATCACATTGGCTAATAA pLKO_005 741 CDS 100% 15.000 10.500 N C1QTNF7 n/a
4 TRCN0000160306 CAGAAGAAAGACTACCTATTA pLKO.1 626 CDS 100% 13.200 9.240 N C1QTNF7 n/a
5 TRCN0000160419 CAGATTACCTAGATTCCATAT pLKO.1 980 CDS 100% 10.800 7.560 N C1QTNF7 n/a
6 TRCN0000166546 CCCAGGTATATCTGCAGCATT pLKO.1 238 CDS 100% 4.950 3.465 N C1QTNF7 n/a
7 TRCN0000164934 GCAATCGGACTGGTACACAAT pLKO.1 769 CDS 100% 4.950 3.465 N C1QTNF7 n/a
8 TRCN0000166679 CAGGGAAGTTCATCTGTGCTT pLKO.1 695 CDS 100% 2.640 1.848 N C1QTNF7 n/a
9 TRCN0000160790 CCAGAAGAAAGACTACCTATT pLKO.1 625 CDS 100% 10.800 6.480 N C1QTNF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.