Transcript: Human XM_011513953.1

PREDICTED: Homo sapiens maestro heat like repeat family member 2B (MROH2B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MROH2B (133558)
Length:
5204
CDS:
601..5172

Additional Resources:

NCBI RefSeq record:
XM_011513953.1
NBCI Gene record:
MROH2B (133558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429245 AGACCATGATGTGGGATAATG pLKO_005 3035 CDS 100% 13.200 18.480 N MROH2B n/a
2 TRCN0000426341 CTTCGTCAAGATCCGTGTATT pLKO_005 5077 CDS 100% 13.200 18.480 N MROH2B n/a
3 TRCN0000134341 GTCAGTAAGTTCATCCCAAAT pLKO.1 3400 CDS 100% 10.800 15.120 N MROH2B n/a
4 TRCN0000419091 CAATTGTCCAACGATTGATTT pLKO_005 563 5UTR 100% 13.200 10.560 N MROH2B n/a
5 TRCN0000437759 GCGGCTGCTAGCTCAACTATT pLKO_005 3259 CDS 100% 13.200 10.560 N MROH2B n/a
6 TRCN0000138488 CCATGTCACTCAGAGCCTAAA pLKO.1 1158 CDS 100% 10.800 8.640 N MROH2B n/a
7 TRCN0000135980 GCCGAGAACCATTTGGATATT pLKO.1 2395 CDS 100% 13.200 9.240 N MROH2B n/a
8 TRCN0000134036 CAGTTGCTCAAAGAATCCTTA pLKO.1 2140 CDS 100% 4.950 3.465 N MROH2B n/a
9 TRCN0000137992 GCTGCAAACAAGGACCTTCTT pLKO.1 4581 CDS 100% 4.950 3.465 N MROH2B n/a
10 TRCN0000135499 GTTCTCAATTTGACCAGCCAA pLKO.1 5008 CDS 100% 2.640 1.848 N MROH2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.