Transcript: Human XM_011513968.3

PREDICTED: Homo sapiens pleckstrin homology and RhoGEF domain containing G4B (PLEKHG4B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHG4B (153478)
Length:
7581
CDS:
122..5002

Additional Resources:

NCBI RefSeq record:
XM_011513968.3
NBCI Gene record:
PLEKHG4B (153478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513968.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412499 TTTAGACATTCCCTAACATTT pLKO_005 5157 3UTR 100% 13.200 18.480 N PLEKHG4B n/a
2 TRCN0000156705 CGGTGCTTAGGATACGTCATT pLKO.1 3650 CDS 100% 4.950 6.930 N PLEKHG4B n/a
3 TRCN0000151814 CTTAGGATACGTCATTGACAA pLKO.1 3655 CDS 100% 4.950 6.930 N PLEKHG4B n/a
4 TRCN0000157395 GCCGGGATGAGTTTATCGTTT pLKO.1 4200 CDS 100% 4.950 6.930 N PLEKHG4B n/a
5 TRCN0000154414 GTTTGGGATGTACGTGATCTA pLKO.1 3856 CDS 100% 4.950 6.930 N PLEKHG4B n/a
6 TRCN0000154920 GCTTGAGGTTTGAGATTTGGT pLKO.1 4380 CDS 100% 3.000 4.200 N PLEKHG4B n/a
7 TRCN0000437662 CCAGGAAGTCGCCGAGTTAAT pLKO_005 2326 CDS 100% 13.200 9.240 N PLEKHG4B n/a
8 TRCN0000157298 CAGTGGCTTGAGGTTTGAGAT pLKO.1 4375 CDS 100% 4.950 3.465 N PLEKHG4B n/a
9 TRCN0000154687 GATGTACGTGATCTACAGCAA pLKO.1 3862 CDS 100% 2.640 1.848 N PLEKHG4B n/a
10 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 6211 3UTR 100% 4.050 2.025 Y INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513968.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.