Transcript: Human XM_011514067.1

PREDICTED: Homo sapiens ANKH inorganic pyrophosphate transport regulator (ANKH), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKH (56172)
Length:
1451
CDS:
295..1347

Additional Resources:

NCBI RefSeq record:
XM_011514067.1
NBCI Gene record:
ANKH (56172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059323 CGGCCTATTGTCAACCTCTTT pLKO.1 1057 CDS 100% 4.950 6.930 N ANKH n/a
2 TRCN0000422372 GGTGGCCTTTGGCTCTAATTC pLKO_005 1016 CDS 100% 13.200 10.560 N ANKH n/a
3 TRCN0000436436 CCTCAATCTCAGATGTCATAG pLKO_005 785 CDS 100% 10.800 8.640 N ANKH n/a
4 TRCN0000059327 CACTGATAGCTTATAGTGATT pLKO.1 599 CDS 100% 4.950 3.465 N ANKH n/a
5 TRCN0000059324 CCTGGGCTACTACAAGAACAT pLKO.1 921 CDS 100% 4.950 3.465 N ANKH n/a
6 TRCN0000098166 GCCTCAATCTCAGATGTCATA pLKO.1 784 CDS 100% 4.950 3.465 N Ank n/a
7 TRCN0000316428 GCCTCAATCTCAGATGTCATA pLKO_005 784 CDS 100% 4.950 3.465 N Ank n/a
8 TRCN0000059325 CTTTCCTTTCATGGACGCAAT pLKO.1 705 CDS 100% 4.050 2.835 N ANKH n/a
9 TRCN0000417047 CCCATGCTGGCATTCTCTTAA pLKO_005 734 CDS 100% 13.200 7.920 N ANKH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.