Transcript: Human XM_011514069.2

PREDICTED: Homo sapiens prolactin receptor (PRLR), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRLR (5618)
Length:
11460
CDS:
200..2068

Additional Resources:

NCBI RefSeq record:
XM_011514069.2
NBCI Gene record:
PRLR (5618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373248 CCTGTATGAAATTCGATTAAA pLKO_005 697 CDS 100% 15.000 21.000 N PRLR n/a
2 TRCN0000373247 ACACTACAGAGTACGTGAAAT pLKO_005 2118 3UTR 100% 13.200 18.480 N PRLR n/a
3 TRCN0000059108 CCCTTGGATTATGTGGAGATT pLKO.1 1715 CDS 100% 4.950 3.960 N PRLR n/a
4 TRCN0000378957 GACTTGCTGGTGGAGTATTTA pLKO_005 1124 CDS 100% 15.000 10.500 N PRLR n/a
5 TRCN0000059109 CCTAGTGACTTCACCATGAAT pLKO.1 878 CDS 100% 5.625 3.938 N PRLR n/a
6 TRCN0000059110 CCACCATCACTTGAACAGAAT pLKO.1 1937 CDS 100% 4.950 3.465 N PRLR n/a
7 TRCN0000059112 CCAGCGACCTTCATTCAGATA pLKO.1 857 CDS 100% 4.950 3.465 N PRLR n/a
8 TRCN0000059111 CTACCAATTATTCACTGACTT pLKO.1 369 CDS 100% 4.950 3.465 N PRLR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.