Transcript: Human XM_011514094.2

PREDICTED: Homo sapiens ciliogenesis and planar polarity effector 1 (CPLANE1), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPLANE1 (65250)
Length:
8397
CDS:
49..7029

Additional Resources:

NCBI RefSeq record:
XM_011514094.2
NBCI Gene record:
CPLANE1 (65250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263909 ATCGTCTGCAGAGTTACATTA pLKO_005 5211 CDS 100% 13.200 18.480 N CPLANE1 n/a
2 TRCN0000263907 ATGCATCATTAGGCATAATTT pLKO_005 7262 3UTR 100% 15.000 10.500 N CPLANE1 n/a
3 TRCN0000263908 CCTGTAGCACAGTGGTATATA pLKO_005 889 CDS 100% 15.000 10.500 N CPLANE1 n/a
4 TRCN0000263911 TATGTCCAAACCGAGTTATAT pLKO_005 6513 CDS 100% 15.000 10.500 N CPLANE1 n/a
5 TRCN0000263910 AGCTATTCAGTGCAATGATAT pLKO_005 2433 CDS 100% 13.200 9.240 N CPLANE1 n/a
6 TRCN0000167501 GTCTGATGAATGAACTGTTAT pLKO.1 6338 CDS 100% 13.200 9.240 N CPLANE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.