Transcript: Human XM_011514156.2

PREDICTED: Homo sapiens semaphorin 5A (SEMA5A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA5A (9037)
Length:
12022
CDS:
931..4155

Additional Resources:

NCBI RefSeq record:
XM_011514156.2
NBCI Gene record:
SEMA5A (9037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063544 CGGGTGTGCAAGAACGATATT pLKO.1 1684 CDS 100% 13.200 18.480 N SEMA5A n/a
2 TRCN0000426958 GCTCGTCCACATCATCTATTT pLKO_005 2175 CDS 100% 13.200 18.480 N SEMA5A n/a
3 TRCN0000063545 CCACAGATTACGGAACCATTA pLKO.1 2198 CDS 100% 10.800 15.120 N SEMA5A n/a
4 TRCN0000413173 ATCTTATGACATCGGAAATTT pLKO_005 1593 CDS 100% 15.000 10.500 N SEMA5A n/a
5 TRCN0000431240 AGAAGTGCATAGGTCCATAAT pLKO_005 4567 3UTR 100% 13.200 9.240 N SEMA5A n/a
6 TRCN0000413057 CCTATTCTAATGCCTACTTTA pLKO_005 4106 CDS 100% 13.200 9.240 N SEMA5A n/a
7 TRCN0000063547 GCATCCAGTCATCTCCTATAA pLKO.1 1032 CDS 100% 13.200 9.240 N SEMA5A n/a
8 TRCN0000063546 CGCGAGGAAAGATACTGCAAT pLKO.1 2845 CDS 100% 4.950 3.465 N SEMA5A n/a
9 TRCN0000063543 GCCGTGTGTGTTTGACTCTAA pLKO.1 3744 CDS 100% 4.950 3.465 N SEMA5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.