Transcript: Human XM_011514393.3

PREDICTED: Homo sapiens PX domain containing 1 (PXDC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PXDC1 (221749)
Length:
2291
CDS:
764..1276

Additional Resources:

NCBI RefSeq record:
XM_011514393.3
NBCI Gene record:
PXDC1 (221749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135897 GCTGAAGACGATCATAAGCAT pLKO.1 898 CDS 100% 3.000 4.200 N PXDC1 n/a
2 TRCN0000158818 GACCCAACAGAGCATTTATTT pLKO.1 1142 CDS 100% 15.000 10.500 N PXDC1 n/a
3 TRCN0000430834 ATCATGAGGTCCAATGGATTT pLKO_005 1049 CDS 100% 10.800 7.560 N Pxdc1 n/a
4 TRCN0000159324 GCTGCCATAATGAACTTGAAA pLKO.1 2064 3UTR 100% 5.625 3.938 N PXDC1 n/a
5 TRCN0000159080 GTTTAGCAAATACCGAAACAA pLKO.1 1071 CDS 100% 5.625 3.938 N PXDC1 n/a
6 TRCN0000160746 CAGCTTTCAAAGTCCAGTCAA pLKO.1 1018 CDS 100% 4.950 3.465 N PXDC1 n/a
7 TRCN0000158784 GATGTTTAGTAATCCAGGATT pLKO.1 1757 3UTR 100% 4.950 3.465 N PXDC1 n/a
8 TRCN0000162983 GAACTGGGATATGTGGCCTTT pLKO.1 1785 3UTR 100% 4.050 2.835 N PXDC1 n/a
9 TRCN0000159147 GCCATAATGAACTTGAAAGGA pLKO.1 2067 3UTR 100% 3.000 2.100 N PXDC1 n/a
10 TRCN0000136725 CCAGCTTTCAAAGTCCAGTCA pLKO.1 1017 CDS 100% 2.640 1.848 N PXDC1 n/a
11 TRCN0000136235 GATTTCTCTGAGAACTGGGAT pLKO.1 1774 3UTR 100% 2.640 1.848 N PXDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.