Transcript: Human XM_011514400.2

PREDICTED: Homo sapiens peroxisomal testis enriched protein 1 (PXT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PXT1 (222659)
Length:
1781
CDS:
143..562

Additional Resources:

NCBI RefSeq record:
XM_011514400.2
NBCI Gene record:
PXT1 (222659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514400.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425689 CCCAGATCATAATCTACTTTC pLKO_005 322 CDS 100% 10.800 15.120 N PXT1 n/a
2 TRCN0000429450 AGTAACACATTGTTGCAAATC pLKO_005 220 CDS 100% 10.800 8.640 N PXT1 n/a
3 TRCN0000127822 GATCTTCAACAGGATGGCAGA pLKO.1 458 CDS 100% 2.160 1.728 N PXT1 n/a
4 TRCN0000432585 AGCATCACCAGGAGGAAATAA pLKO_005 372 CDS 100% 15.000 10.500 N PXT1 n/a
5 TRCN0000147024 CAGAGATGCACTAGATCATTT pLKO.1 475 CDS 100% 13.200 9.240 N PXT1 n/a
6 TRCN0000149240 GCAGAGATGCACTAGATCATT pLKO.1 474 CDS 100% 5.625 3.938 N PXT1 n/a
7 TRCN0000128709 CCTTCCAGGAATGAAAGAGAA pLKO.1 884 3UTR 100% 4.950 3.465 N PXT1 n/a
8 TRCN0000148356 CATCTCATCTACCTTCCCATT pLKO.1 1139 3UTR 100% 4.050 2.835 N PXT1 n/a
9 TRCN0000178864 CTGGAACAACCATTTGCTGTA pLKO.1 541 CDS 100% 4.050 2.835 N Pxt1 n/a
10 TRCN0000150211 CTTTAGAAGAGTTCAGGTGTT pLKO.1 508 CDS 100% 4.050 2.835 N PXT1 n/a
11 TRCN0000127879 GAGAGGATCTTCAACAGGATG pLKO.1 453 CDS 100% 4.050 2.835 N PXT1 n/a
12 TRCN0000146449 CCTGCCTTCTAGAAGAATGTA pLKO.1 1415 3UTR 100% 5.625 3.375 N PXT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514400.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13438 pDONR223 100% 36.6% 36.6% None 1_264del n/a
2 ccsbBroad304_13438 pLX_304 0% 36.6% 36.6% V5 1_264del n/a
Download CSV