Transcript: Human XM_011514425.1

PREDICTED: Homo sapiens cullin 9 (CUL9), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUL9 (23113)
Length:
7597
CDS:
85..7455

Additional Resources:

NCBI RefSeq record:
XM_011514425.1
NBCI Gene record:
CUL9 (23113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427037 AGCGGTTTCAGGACTATAATG pLKO_005 6773 CDS 100% 13.200 18.480 N CUL9 n/a
2 TRCN0000429363 GCTCGTCTACTTCACGAAATC pLKO_005 1496 CDS 100% 10.800 15.120 N CUL9 n/a
3 TRCN0000004450 GCAGGTTCTCAGTAGTCGATT pLKO.1 1398 CDS 100% 4.950 3.960 N CUL9 n/a
4 TRCN0000004449 CCATCTTTCAGCCCTACATTT pLKO.1 1091 CDS 100% 13.200 9.240 N CUL9 n/a
5 TRCN0000413352 AGCAGTTTGCCAGGTACATTG pLKO_005 4541 CDS 100% 10.800 7.560 N CUL9 n/a
6 TRCN0000424584 GATCTCTGTGTCCGTGGAAAT pLKO_005 1362 CDS 100% 10.800 7.560 N CUL9 n/a
7 TRCN0000004447 CCTTGACCGTTTCTCCAGTTT pLKO.1 5082 CDS 100% 4.950 3.465 N CUL9 n/a
8 TRCN0000004451 GCTGGAATGAGTACCTGACAA pLKO.1 6188 CDS 100% 4.950 3.465 N CUL9 n/a
9 TRCN0000004448 TCTGTAGTGCTTCCTGTTTGC pLKO.1 7550 3UTR 100% 4.050 2.835 N CUL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.