Transcript: Human XM_011514725.3

PREDICTED: Homo sapiens mitochondrial ribosomal protein S10 (MRPS10), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPS10 (55173)
Length:
2142
CDS:
22..654

Additional Resources:

NCBI RefSeq record:
XM_011514725.3
NBCI Gene record:
MRPS10 (55173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514725.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135568 GTAAACACTTCTAAGGGCAAT pLKO.1 118 CDS 100% 4.050 5.670 N MRPS10 n/a
2 TRCN0000338608 ACGCTACTGGTGTTCAATTAT pLKO_005 928 3UTR 100% 15.000 12.000 N MRPS10 n/a
3 TRCN0000137107 CCTGTGGTAACAATCTCTGAT pLKO.1 229 CDS 100% 4.950 3.960 N MRPS10 n/a
4 TRCN0000135242 CTTCTCCAATCAGTGCATATT pLKO.1 406 CDS 100% 13.200 9.240 N MRPS10 n/a
5 TRCN0000338606 CTTCTCCAATCAGTGCATATT pLKO_005 406 CDS 100% 13.200 9.240 N MRPS10 n/a
6 TRCN0000135547 GCACATCTTTGGAGTAGTTAT pLKO.1 1964 3UTR 100% 13.200 9.240 N MRPS10 n/a
7 TRCN0000135309 CGTTGATGTTCCAAAGGATTT pLKO.1 201 CDS 100% 10.800 7.560 N MRPS10 n/a
8 TRCN0000135527 CAATATGAAGTGGGTACAGTT pLKO.1 168 CDS 100% 4.950 3.465 N MRPS10 n/a
9 TRCN0000135412 GTGGTAACAATCTCTGATGAA pLKO.1 232 CDS 100% 4.950 3.465 N MRPS10 n/a
10 TRCN0000338605 GTGGTAACAATCTCTGATGAA pLKO_005 232 CDS 100% 4.950 3.465 N MRPS10 n/a
11 TRCN0000137875 CAGAACACATCAAGGAGCCAA pLKO.1 590 CDS 100% 2.640 1.848 N MRPS10 n/a
12 TRCN0000135861 GCAGATGTCTACTTGGAATAT pLKO.1 505 CDS 100% 13.200 7.920 N MRPS10 n/a
13 TRCN0000338607 GCAGATGTCTACTTGGAATAT pLKO_005 505 CDS 100% 13.200 7.920 N MRPS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514725.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.