Transcript: Human XM_011514928.3

PREDICTED: Homo sapiens chromosome 6 open reading frame 62 (C6orf62), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C6orf62 (81688)
Length:
3460
CDS:
1020..1622

Additional Resources:

NCBI RefSeq record:
XM_011514928.3
NBCI Gene record:
C6orf62 (81688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136140 GAGTTTCATCATGGTGACTAT pLKO.1 1371 CDS 100% 4.950 6.930 N C6orf62 n/a
2 TRCN0000292189 GAGTTTCATCATGGTGACTAT pLKO_005 1371 CDS 100% 4.950 6.930 N C6orf62 n/a
3 TRCN0000135973 GAATCGTTGTCAACAATCCTA pLKO.1 1435 CDS 100% 3.000 4.200 N C6orf62 n/a
4 TRCN0000189715 GCGAGATTCCAGCTATTCCTT pLKO.1 1145 CDS 100% 3.000 4.200 N BC005537 n/a
5 TRCN0000293014 GCGAGATTCCAGCTATTCCTT pLKO_005 1145 CDS 100% 3.000 4.200 N BC005537 n/a
6 TRCN0000298096 TTGAAGTGTCTGAGGTTATAC pLKO_005 1081 CDS 100% 13.200 9.240 N BC005537 n/a
7 TRCN0000137084 CCAGCTATTCCTTGGAAAGTT pLKO.1 1153 CDS 100% 5.625 3.938 N C6orf62 n/a
8 TRCN0000292244 CCAGCTATTCCTTGGAAAGTT pLKO_005 1153 CDS 100% 5.625 3.938 N C6orf62 n/a
9 TRCN0000201649 CAATCCTAACCAGTCAGTGTT pLKO.1 1448 CDS 100% 4.950 3.465 N BC005537 n/a
10 TRCN0000136769 CTAACCAGTCAGTGTTTCTCT pLKO.1 1453 CDS 100% 3.000 2.100 N C6orf62 n/a
11 TRCN0000137514 GATTCCAGCTATTCCTTGGAA pLKO.1 1149 CDS 100% 0.300 0.210 N C6orf62 n/a
12 TRCN0000136293 GAAAGAATCTGATGAGCCTTT pLKO.1 1328 CDS 100% 4.050 2.430 N C6orf62 n/a
13 TRCN0000292243 GAAAGAATCTGATGAGCCTTT pLKO_005 1328 CDS 100% 4.050 2.430 N C6orf62 n/a
14 TRCN0000135866 CAATCTTCAAGTTATGCAGCA pLKO.1 1516 CDS 100% 2.160 1.296 N C6orf62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.