Transcript: Human XM_011515021.1

PREDICTED: Homo sapiens cullin 7 (CUL7), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUL7 (9820)
Length:
3554
CDS:
514..3483

Additional Resources:

NCBI RefSeq record:
XM_011515021.1
NBCI Gene record:
CUL7 (9820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006480 CGCTACTGTGAGCACTTTAAT pLKO.1 1885 CDS 100% 15.000 21.000 N CUL7 n/a
2 TRCN0000006484 GACATGCTCAATCAGGCGATT pLKO.1 2860 CDS 100% 4.050 5.670 N CUL7 n/a
3 TRCN0000006481 CCTGATCAACTGCCATGTCTA pLKO.1 5 5UTR 100% 4.950 3.465 N CUL7 n/a
4 TRCN0000006482 GCACCTGAGTTCTAGACTCAA pLKO.1 1398 CDS 100% 0.495 0.347 N CUL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.