Transcript: Human XM_011515162.1

PREDICTED: Homo sapiens AE binding protein 1 (AEBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AEBP1 (165)
Length:
4048
CDS:
347..3745

Additional Resources:

NCBI RefSeq record:
XM_011515162.1
NBCI Gene record:
AEBP1 (165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234575 GGGATGGAGTCACACCGTATT pLKO_005 1433 CDS 100% 10.800 15.120 N AEBP1 n/a
2 TRCN0000234577 CAAACATGACTGGGACCTAAG pLKO_005 3899 3UTR 100% 6.000 8.400 N AEBP1 n/a
3 TRCN0000021228 GACCGGGACTATCAATGACTT pLKO.1 2830 CDS 100% 4.950 6.930 N AEBP1 n/a
4 TRCN0000234573 AGATCGAGAGGGAGGACTATG pLKO_005 1059 CDS 100% 10.800 7.560 N AEBP1 n/a
5 TRCN0000234576 CACGAGGCCTCAAGATCTATG pLKO_005 2049 CDS 100% 10.800 7.560 N AEBP1 n/a
6 TRCN0000021226 CTACAGCTACTACGCACAGAA pLKO.1 1903 CDS 100% 4.950 3.465 N AEBP1 n/a
7 TRCN0000021224 TGGTGGTGATTACTGGCGAAT pLKO.1 3082 CDS 100% 4.050 2.835 N AEBP1 n/a
8 TRCN0000021227 CCCTCTCAAATAACTGGCAGA pLKO.1 948 CDS 100% 2.160 1.512 N AEBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.