Transcript: Human XM_011515230.2

PREDICTED: Homo sapiens sorting nexin 13 (SNX13), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX13 (23161)
Length:
5827
CDS:
511..3177

Additional Resources:

NCBI RefSeq record:
XM_011515230.2
NBCI Gene record:
SNX13 (23161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230364 GTATTGGTATCCCAGTTATTT pLKO_005 4638 3UTR 100% 15.000 21.000 N SNX13 n/a
2 TRCN0000380536 CCTACTTCAACAGCTTATTAG pLKO_005 2700 CDS 100% 13.200 18.480 N SNX13 n/a
3 TRCN0000230363 TCGGCTCAACTTGACGATAAT pLKO_005 2581 CDS 100% 13.200 18.480 N SNX13 n/a
4 TRCN0000218638 TGGATGAAGTATTCGACTTAA pLKO_005 2642 CDS 100% 13.200 18.480 N SNX13 n/a
5 TRCN0000218843 GTTTCAGCACAACCAATTAAA pLKO_005 2994 CDS 100% 15.000 12.000 N SNX13 n/a
6 TRCN0000379495 TGAAAGTCTCTCAAGCATATT pLKO_005 2151 CDS 100% 13.200 10.560 N SNX13 n/a
7 TRCN0000381846 TGGCACACACTTACGAGTATT pLKO_005 765 CDS 100% 13.200 10.560 N SNX13 n/a
8 TRCN0000152243 CGTGATTCTAACTGCAACTAT pLKO.1 1111 CDS 100% 5.625 4.500 N SNX13 n/a
9 TRCN0000150740 GATGAGCTGAAGCACATTATT pLKO.1 2929 CDS 100% 15.000 10.500 N SNX13 n/a
10 TRCN0000380086 AGGAGTTTGTTTGGCATAATG pLKO_005 3595 3UTR 100% 13.200 9.240 N SNX13 n/a
11 TRCN0000218501 TACAACTTCATGCCTACATTT pLKO_005 1946 CDS 100% 13.200 9.240 N SNX13 n/a
12 TRCN0000380331 GAACCTCTCCAGCAAGTTATC pLKO_005 574 CDS 100% 10.800 7.560 N SNX13 n/a
13 TRCN0000151449 CGCAATTCAATGAGGAATGTT pLKO.1 2392 CDS 100% 5.625 3.938 N SNX13 n/a
14 TRCN0000150357 CCCTGAAATCTTTGATGACAT pLKO.1 1704 CDS 100% 4.950 3.465 N SNX13 n/a
15 TRCN0000153538 CCAGAACAAGATCATGCGATA pLKO.1 993 CDS 100% 4.050 2.835 N SNX13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.