Transcript: Human XM_011515401.2

PREDICTED: Homo sapiens extracellular leucine rich repeat and fibronectin type III domain containing 1 (ELFN1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELFN1 (392617)
Length:
7186
CDS:
3837..6323

Additional Resources:

NCBI RefSeq record:
XM_011515401.2
NBCI Gene record:
ELFN1 (392617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245758 GTACACTGTAGTCGTTCTATT pLKO_005 7031 3UTR 100% 13.200 18.480 N ELFN1 n/a
2 TRCN0000245756 AGTGTCCCAACATCGTCAACA pLKO_005 4297 CDS 100% 4.950 6.930 N ELFN1 n/a
3 TRCN0000245759 TGTTCACGCTCACCAACTACA pLKO_005 4948 CDS 100% 4.950 3.960 N ELFN1 n/a
4 TRCN0000245757 GATGTACACCCTGGAGCATTT pLKO_005 4859 CDS 100% 10.800 6.480 N ELFN1 n/a
5 TRCN0000245760 AGAAGGTTCAGTTCGCCAAAG pLKO_005 6241 CDS 100% 6.000 3.600 N ELFN1 n/a
6 TRCN0000153005 GACAAGGTCAACCAGATCATT pLKO.1 5523 CDS 100% 5.625 2.813 Y ELFN2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6543 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.