Transcript: Human XM_011515453.2

PREDICTED: Homo sapiens core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 (C1GALT1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C1GALT1 (56913)
Length:
6401
CDS:
421..1512

Additional Resources:

NCBI RefSeq record:
XM_011515453.2
NBCI Gene record:
C1GALT1 (56913)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035413 CCTACCTTACCTGAACGTATA pLKO.1 1429 CDS 100% 10.800 15.120 N C1GALT1 n/a
2 TRCN0000289447 CCTACCTTACCTGAACGTATA pLKO_005 1429 CDS 100% 10.800 15.120 N C1GALT1 n/a
3 TRCN0000035409 GCGTTGTAACAAAGTGTTGTT pLKO.1 759 CDS 100% 0.495 0.396 N C1GALT1 n/a
4 TRCN0000306827 GCGTTGTAACAAAGTGTTGTT pLKO_005 759 CDS 100% 0.495 0.396 N C1GALT1 n/a
5 TRCN0000035411 CCCAGCCTAATGTTCTTCATA pLKO.1 530 CDS 100% 5.625 3.938 N C1GALT1 n/a
6 TRCN0000289384 CCCAGCCTAATGTTCTTCATA pLKO_005 530 CDS 100% 5.625 3.938 N C1GALT1 n/a
7 TRCN0000035412 GCTCTGATCTTGCAGTTTCTT pLKO.1 1322 CDS 100% 5.625 3.938 N C1GALT1 n/a
8 TRCN0000289382 GCTCTGATCTTGCAGTTTCTT pLKO_005 1322 CDS 100% 5.625 3.938 N C1GALT1 n/a
9 TRCN0000035410 GCCTTATGTAAAGCAGGGCTA pLKO.1 1017 CDS 100% 2.160 1.512 N C1GALT1 n/a
10 TRCN0000289383 GCCTTATGTAAAGCAGGGCTA pLKO_005 1017 CDS 100% 2.160 1.512 N C1GALT1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3220 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3220 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.