Transcript: Human XM_011515464.2

PREDICTED: Homo sapiens myosin light chain 7 (MYL7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYL7 (58498)
Length:
770
CDS:
87..713

Additional Resources:

NCBI RefSeq record:
XM_011515464.2
NBCI Gene record:
MYL7 (58498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053787 TGTATCGACCAGAATCGTGAT pLKO.1 213 CDS 100% 4.050 5.670 N MYL7 n/a
2 TRCN0000053786 GAGCAGATGTTCGCCCTGACA pLKO.1 615 CDS 100% 0.880 1.232 N MYL7 n/a
3 TRCN0000053784 GCCCAGATACAGGAGTTCAAA pLKO.1 180 CDS 100% 5.625 3.938 N MYL7 n/a
4 TRCN0000053783 CGTGGTTCTTCCAACGTCTTT pLKO.1 144 CDS 100% 4.950 3.465 N MYL7 n/a
5 TRCN0000419984 AGGATGAGTTCAAGCAGCTTC pLKO_005 457 CDS 100% 4.050 2.835 N MYL7 n/a
6 TRCN0000436199 AGAAGCTCAATGGGACAGACC pLKO_005 373 CDS 100% 2.160 1.296 N MYL7 n/a
7 TRCN0000053785 CCTGAGTGCCTTCCGCATGTT pLKO.1 407 CDS 100% 1.650 0.990 N MYL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.