Transcript: Human XM_011515780.2

PREDICTED: Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 (AGAP3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGAP3 (116988)
Length:
3241
CDS:
698..2749

Additional Resources:

NCBI RefSeq record:
XM_011515780.2
NBCI Gene record:
AGAP3 (116988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444159 GATTTAGCCCTCTGCCCTAAG pLKO_005 2944 3UTR 100% 6.000 8.400 N AGAP3 n/a
2 TRCN0000437542 GGTAGTGGCCTTGCGAAAGAA pLKO_005 865 CDS 100% 5.625 7.875 N AGAP3 n/a
3 TRCN0000048001 GCAGAGGAGTCGTTTGAATTT pLKO.1 1820 CDS 100% 13.200 10.560 N AGAP3 n/a
4 TRCN0000047999 GCAGACATCTTGATCCAGCAT pLKO.1 2624 CDS 100% 2.640 2.112 N AGAP3 n/a
5 TRCN0000444944 GTTCAGCCTGGAGGATGAAAT pLKO_005 610 5UTR 100% 13.200 9.240 N Agap3 n/a
6 TRCN0000438422 CACACGCCTTCATCCTGAAAC pLKO_005 3065 3UTR 100% 10.800 7.560 N AGAP3 n/a
7 TRCN0000048002 CCGTAGTCCTAGCCTCCTATA pLKO.1 2728 CDS 100% 10.800 7.560 N AGAP3 n/a
8 TRCN0000440510 TGAAGCGGTGCACCTACTATG pLKO_005 786 CDS 100% 10.800 7.560 N AGAP3 n/a
9 TRCN0000438806 ACATCAACCAGGCCACGAATG pLKO_005 972 CDS 100% 6.000 4.200 N AGAP3 n/a
10 TRCN0000429939 GAGCTTAAAGTGGGCATAGTG pLKO_005 392 5UTR 100% 4.950 3.465 N AGAP3 n/a
11 TRCN0000438364 GGATACGGGCCAAGTATGAAC pLKO_005 2304 CDS 100% 4.950 3.465 N AGAP3 n/a
12 TRCN0000421896 TCAGTTTCCAGACGGTGTACA pLKO_005 630 5UTR 100% 4.950 3.465 N AGAP3 n/a
13 TRCN0000442748 TGCCATGGCCAACGTTGTCTT pLKO_005 2503 CDS 100% 4.950 3.465 N AGAP3 n/a
14 TRCN0000425911 TGCTGCGGACAACGGTGAAAG pLKO_005 1377 CDS 100% 3.600 2.520 N AGAP3 n/a
15 TRCN0000047998 CCTGCATGATTACATGCAGAA pLKO.1 1333 CDS 100% 0.405 0.284 N AGAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.