Transcript: Human XM_011515978.1

PREDICTED: Homo sapiens laminin subunit beta 4 (LAMB4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LAMB4 (22798)
Length:
5576
CDS:
85..5256

Additional Resources:

NCBI RefSeq record:
XM_011515978.1
NBCI Gene record:
LAMB4 (22798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157387 GCGAATGGTGTGCTTGACATT pLKO.1 4591 CDS 100% 4.950 3.960 N LAMB4 n/a
2 TRCN0000154079 CCCATCTGTTTAGAACCAGAT pLKO.1 2107 CDS 100% 0.405 0.324 N LAMB4 n/a
3 TRCN0000153340 GCTCTGTACGAGATGATTGTT pLKO.1 847 CDS 100% 5.625 3.938 N LAMB4 n/a
4 TRCN0000154101 CCAGTGCCTTTGTAAAGAGAA pLKO.1 1347 CDS 100% 4.950 3.465 N LAMB4 n/a
5 TRCN0000153798 CCTGCTGCAATGTTAGTTGAA pLKO.1 496 CDS 100% 4.950 3.465 N LAMB4 n/a
6 TRCN0000152858 GCTGTCAACAACATTCCCTTT pLKO.1 1912 CDS 100% 4.050 2.835 N LAMB4 n/a
7 TRCN0000157765 CCCTTGCCCTTGTAATAGGTT pLKO.1 2667 CDS 100% 3.000 2.100 N LAMB4 n/a
8 TRCN0000152524 GTGACTCCAAATACTCGGATA pLKO.1 632 CDS 100% 4.050 2.430 N LAMB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.