Transcript: Human XM_011516003.2

PREDICTED: Homo sapiens ubinuclein 2 (UBN2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBN2 (254048)
Length:
6930
CDS:
3078..6788

Additional Resources:

NCBI RefSeq record:
XM_011516003.2
NBCI Gene record:
UBN2 (254048)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419267 ATGTCCAGGATGATCGTTTAA pLKO_005 4666 CDS 100% 13.200 18.480 N UBN2 n/a
2 TRCN0000122877 GCCCAAGATGCTTCTTCGTTA pLKO.1 5826 CDS 100% 4.950 6.930 N UBN2 n/a
3 TRCN0000121607 CGGCTACAAGATTTAATTGAT pLKO.1 3669 CDS 100% 5.625 4.500 N UBN2 n/a
4 TRCN0000085764 GCAGGGTTTCAAATCTCCCTT pLKO.1 6149 CDS 100% 2.640 2.112 N Ubn2 n/a
5 TRCN0000422835 CCACTACCTCCAGTAACTATT pLKO_005 6097 CDS 100% 13.200 9.240 N UBN2 n/a
6 TRCN0000122190 GCTATGAGTTAGAACCAAATA pLKO.1 4945 CDS 100% 13.200 9.240 N UBN2 n/a
7 TRCN0000434131 TAACCTTGTTGAGATCAAATT pLKO_005 4919 CDS 100% 13.200 9.240 N Ubn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.