Transcript: Human XM_011516615.3

PREDICTED: Homo sapiens cortactin binding protein 2 (CTTNBP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTTNBP2 (83992)
Length:
8277
CDS:
2451..7388

Additional Resources:

NCBI RefSeq record:
XM_011516615.3
NBCI Gene record:
CTTNBP2 (83992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516615.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129274 CCACCTCCAAGTGCAAACAAA pLKO.1 3516 CDS 100% 5.625 3.938 N CTTNBP2 n/a
2 TRCN0000149478 GCAGCAGTAATACAAGGCAAA pLKO.1 7291 CDS 100% 4.050 2.835 N CTTNBP2 n/a
3 TRCN0000128559 GTTTGCATTATGACTCCTGTA pLKO.1 8016 3UTR 100% 4.050 2.835 N CTTNBP2 n/a
4 TRCN0000149972 CCCTAGTTTCTGCAAATGCAA pLKO.1 3400 CDS 100% 3.000 2.100 N CTTNBP2 n/a
5 TRCN0000130293 CCAGGAAGTTATGCCAACTTT pLKO.1 7601 3UTR 100% 0.563 0.394 N CTTNBP2 n/a
6 TRCN0000128938 CGAGTCAAGTGTCTTTGACTT pLKO.1 5033 CDS 100% 0.495 0.347 N CTTNBP2 n/a
7 TRCN0000254363 TTGTACCTAAGTGGATATAAA pLKO_005 8086 3UTR 100% 15.000 10.500 N Cttnbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516615.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.