Transcript: Human XM_011516720.3

PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAGI2 (9863)
Length:
22590
CDS:
16197..20330

Additional Resources:

NCBI RefSeq record:
XM_011516720.3
NBCI Gene record:
MAGI2 (9863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516720.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149928 GATCCCATTTATGGCACTTAT pLKO.1 16782 CDS 100% 13.200 18.480 N MAGI2 n/a
2 TRCN0000240507 AGGTCCCTGGAGTGGATTATA pLKO_005 16153 5UTR 100% 15.000 10.500 N MAGI2 n/a
3 TRCN0000240510 GATGAGGGTAGGAGATCAAAT pLKO_005 19397 CDS 100% 13.200 9.240 N MAGI2 n/a
4 TRCN0000240508 GGCAGTCCTCAAACGAGTTTA pLKO_005 17940 CDS 100% 13.200 9.240 N MAGI2 n/a
5 TRCN0000240506 TATGATTGACCTCCTAGTAAA pLKO_005 21554 3UTR 100% 13.200 9.240 N MAGI2 n/a
6 TRCN0000240803 ATATGAGCTCTACGAGAAATC pLKO_005 18062 CDS 100% 10.800 7.560 N Magi2 n/a
7 TRCN0000148546 CAAGCTGAACTTATGACCTTA pLKO.1 17634 CDS 100% 4.950 3.465 N MAGI2 n/a
8 TRCN0000180641 CCAGGAGATGAGCTTGTGTAT pLKO.1 18297 CDS 100% 4.950 3.465 N MAGI2 n/a
9 TRCN0000148688 CAAAGGATTTGGATTCAGCAT pLKO.1 19298 CDS 100% 2.640 1.848 N MAGI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516720.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.