Transcript: Human XM_011516889.2

PREDICTED: Homo sapiens collagen type XXII alpha 1 chain (COL22A1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL22A1 (169044)
Length:
4498
CDS:
304..3480

Additional Resources:

NCBI RefSeq record:
XM_011516889.2
NBCI Gene record:
COL22A1 (169044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244099 GAAACCCTGCGTCGGCTTATT pLKO_005 2983 CDS 100% 13.200 9.240 N COL22A1 n/a
2 TRCN0000244098 GGGAACCTGGCTATGCTAAAG pLKO_005 3302 CDS 100% 10.800 7.560 N COL22A1 n/a
3 TRCN0000244095 GTAATGTGAAGGGTCCCTAAA pLKO_005 3461 CDS 100% 10.800 7.560 N COL22A1 n/a
4 TRCN0000168474 GAACCTGGCTATGCTAAAGAT pLKO.1 3304 CDS 100% 5.625 3.938 N COL22A1 n/a
5 TRCN0000244096 TGCCGGTCGGTCAGATTATTA pLKO_005 3661 3UTR 100% 15.000 9.000 N COL22A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.