Transcript: Human XM_011516963.2

PREDICTED: Homo sapiens MDM2 binding protein (MTBP), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTBP (27085)
Length:
3194
CDS:
71..1525

Additional Resources:

NCBI RefSeq record:
XM_011516963.2
NBCI Gene record:
MTBP (27085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425059 GGAGAGTGTTCTAGCTATTAT pLKO_005 1256 CDS 100% 15.000 21.000 N MTBP n/a
2 TRCN0000134565 GCCATGTACCATTAGTAACAT pLKO.1 1138 CDS 100% 5.625 7.875 N MTBP n/a
3 TRCN0000133797 CAGTAATAGCAGGGAATCATT pLKO.1 463 CDS 100% 5.625 4.500 N MTBP n/a
4 TRCN0000454970 AGATGTTCTTCAAACGAATAT pLKO_005 400 CDS 100% 13.200 9.240 N MTBP n/a
5 TRCN0000135864 CAACCAGATCAATGGCTCATT pLKO.1 1333 CDS 100% 4.950 2.970 N MTBP n/a
6 TRCN0000138503 CCAACCAGATCAATGGCTCAT pLKO.1 1332 CDS 100% 4.050 2.430 N MTBP n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3018 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3018 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.