Transcript: Human XM_011517625.2

PREDICTED: Homo sapiens transient receptor potential cation channel subfamily A member 1 (TRPA1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPA1 (8989)
Length:
9453
CDS:
5151..8510

Additional Resources:

NCBI RefSeq record:
XM_011517625.2
NBCI Gene record:
TRPA1 (8989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434290 TGCCTTAGATGATAGTCTTAA pLKO_005 8922 3UTR 100% 13.200 18.480 N TRPA1 n/a
2 TRCN0000044799 CGAGACTATTATATCGAGTAT pLKO.1 7104 CDS 100% 4.950 6.930 N TRPA1 n/a
3 TRCN0000428619 CATGAGCTAGCAGACTATTTA pLKO_005 6114 CDS 100% 15.000 12.000 N TRPA1 n/a
4 TRCN0000417945 ATGATGAATTTAGGATCTTAC pLKO_005 7308 CDS 100% 10.800 7.560 N TRPA1 n/a
5 TRCN0000044798 CCAGGCAATAAATGTCCAATT pLKO.1 6999 CDS 100% 10.800 7.560 N TRPA1 n/a
6 TRCN0000044801 GCAATGTTCTTGAATGGATTA pLKO.1 7561 CDS 100% 10.800 7.560 N TRPA1 n/a
7 TRCN0000044802 CCACAAATAATAGCGAAGCAT pLKO.1 5671 CDS 100% 3.000 2.100 N TRPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.