Transcript: Human XM_011517705.2

PREDICTED: Homo sapiens ubiquitin like with PHD and ring finger domains 2 (UHRF2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UHRF2 (115426)
Length:
2752
CDS:
138..1877

Additional Resources:

NCBI RefSeq record:
XM_011517705.2
NBCI Gene record:
UHRF2 (115426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364093 GTAATGTGGCTTATCATATTT pLKO_005 562 CDS 100% 15.000 12.000 N UHRF2 n/a
2 TRCN0000003479 CGTCTCTTCTTCCATTACAAT pLKO.1 2350 3UTR 100% 5.625 4.500 N UHRF2 n/a
3 TRCN0000412720 GATGCTCCATTGGATGATAAA pLKO_005 1092 CDS 100% 13.200 9.240 N Uhrf2 n/a
4 TRCN0000040626 GCAACAGATATGATGGCATTT pLKO.1 1210 CDS 100% 10.800 7.560 N Uhrf2 n/a
5 TRCN0000368926 GTACGAGAGAATGTACTATTG pLKO_005 772 CDS 100% 10.800 7.560 N UHRF2 n/a
6 TRCN0000003481 ACTGGTATTGTCCTTCTTGTA pLKO.1 625 CDS 100% 4.950 3.465 N UHRF2 n/a
7 TRCN0000003480 GAAGTTGTAAAGGCTGGTGAA pLKO.1 660 CDS 100% 4.050 2.835 N UHRF2 n/a
8 TRCN0000010793 GTTGGTGATGTGGTAATGGTT pLKO.1 198 CDS 100% 3.000 2.100 N UHRF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.