Transcript: Human XM_011517945.2

PREDICTED: Homo sapiens focadhesin (FOCAD), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOCAD (54914)
Length:
5682
CDS:
58..5358

Additional Resources:

NCBI RefSeq record:
XM_011517945.2
NBCI Gene record:
FOCAD (54914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005797 CCAGTATGTATGGTACAATAT pLKO.1 1178 CDS 100% 13.200 18.480 N FOCAD n/a
2 TRCN0000335848 CCAGTATGTATGGTACAATAT pLKO_005 1178 CDS 100% 13.200 18.480 N FOCAD n/a
3 TRCN0000005799 GCCCTGCTGAAAGTCTTACTT pLKO.1 541 CDS 100% 5.625 7.875 N FOCAD n/a
4 TRCN0000335847 GCCCTGCTGAAAGTCTTACTT pLKO_005 541 CDS 100% 5.625 7.875 N FOCAD n/a
5 TRCN0000005796 GCCAAATAAGATTCGGAGAAA pLKO.1 4575 CDS 100% 4.950 3.960 N FOCAD n/a
6 TRCN0000335934 AGACCACTGGAACCTATATTA pLKO_005 1447 CDS 100% 15.000 10.500 N FOCAD n/a
7 TRCN0000005798 GCATACATGAATCGAGCTTAT pLKO.1 2635 CDS 100% 10.800 7.560 N FOCAD n/a
8 TRCN0000335933 GCATACATGAATCGAGCTTAT pLKO_005 2635 CDS 100% 10.800 7.560 N FOCAD n/a
9 TRCN0000005795 GAGGAGTGCATTGCTTTAGTA pLKO.1 5525 3UTR 100% 5.625 3.375 N FOCAD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.