Transcript: Human XM_011518214.2

PREDICTED: Homo sapiens collagen type XV alpha 1 chain (COL15A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL15A1 (1306)
Length:
5403
CDS:
345..4511

Additional Resources:

NCBI RefSeq record:
XM_011518214.2
NBCI Gene record:
COL15A1 (1306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148445 CCTTTGATGGTCGAGACATAA pLKO.1 4261 CDS 100% 13.200 18.480 N COL15A1 n/a
2 TRCN0000365217 CTTTGATGGTCGAGACATAAT pLKO_005 4262 CDS 100% 13.200 18.480 N COL15A1 n/a
3 TRCN0000365276 ACGCATCCCAACATAGGTTAA pLKO_005 4758 3UTR 100% 10.800 15.120 N COL15A1 n/a
4 TRCN0000365277 ACGGAGTAGCTGAGATCTTAG pLKO_005 1102 CDS 100% 10.800 15.120 N COL15A1 n/a
5 TRCN0000370404 TTTCACGTACATCCATCATTT pLKO_005 4951 3UTR 100% 13.200 10.560 N COL15A1 n/a
6 TRCN0000148105 GCATCCTTCAGACAGTTATAT pLKO.1 4817 3UTR 100% 15.000 10.500 N COL15A1 n/a
7 TRCN0000183330 GCCATCATGCTTTAGGAATTT pLKO.1 5072 3UTR 100% 13.200 9.240 N COL15A1 n/a
8 TRCN0000365278 GCCTCCACCAAACCCTATTTC pLKO_005 3950 CDS 100% 13.200 9.240 N COL15A1 n/a
9 TRCN0000370347 GCTGTGCTAATCGGCTAATTG pLKO_005 4447 CDS 100% 13.200 9.240 N COL15A1 n/a
10 TRCN0000376591 TGTCTAATTCCTTGATCAATA pLKO_005 2746 CDS 100% 13.200 9.240 N COL15A1 n/a
11 TRCN0000370348 CCAGATAATGAAGAGCGTTTA pLKO_005 1548 CDS 100% 10.800 7.560 N COL15A1 n/a
12 TRCN0000147569 GACTGCTCAAATGATCCTATT pLKO.1 4999 3UTR 100% 10.800 7.560 N COL15A1 n/a
13 TRCN0000147568 GAGACATAATGACAGATCCTT pLKO.1 4273 CDS 100% 3.000 2.100 N COL15A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.