Transcript: Human XM_011518230.2

PREDICTED: Homo sapiens chromosome 9 open reading frame 135 (C9orf135), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C9orf135 (138255)
Length:
937
CDS:
77..640

Additional Resources:

NCBI RefSeq record:
XM_011518230.2
NBCI Gene record:
C9orf135 (138255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138242 CGTTCTCAGTTCACGGATCTA pLKO.1 699 3UTR 100% 4.950 6.930 N C9orf135 n/a
2 TRCN0000137845 GAAATACTCGAAGCCGGTGTT pLKO.1 196 CDS 100% 4.050 5.670 N C9orf135 n/a
3 TRCN0000133707 GACAACGTACTCAGAAGATTA pLKO.1 605 CDS 100% 13.200 10.560 N C9orf135 n/a
4 TRCN0000133927 CCTGTCAAGATGATTATTCCA pLKO.1 661 3UTR 100% 3.000 2.400 N C9orf135 n/a
5 TRCN0000133837 CCATCACAAGAAATACTCGAA pLKO.1 187 CDS 100% 2.640 2.112 N C9orf135 n/a
6 TRCN0000137569 CAAGAAATACTCGAAGCCGGT pLKO.1 193 CDS 100% 0.540 0.432 N C9orf135 n/a
7 TRCN0000138748 GAAGCAACACTGGTTGGAGAT pLKO.1 118 CDS 100% 4.050 2.835 N C9orf135 n/a
8 TRCN0000134815 CAAGGCTTTATTGAATGAGGA pLKO.1 409 CDS 100% 2.640 1.848 N C9orf135 n/a
9 TRCN0000134113 CAGAAGATTATGTTCCACCAT pLKO.1 616 CDS 100% 2.640 1.848 N C9orf135 n/a
10 TRCN0000138061 GCTGTCTTTCCTAGACATCCA pLKO.1 488 CDS 100% 0.264 0.185 N C9orf135 n/a
11 TRCN0000134966 CCATATGATTATCAGCCACAT pLKO.1 633 CDS 100% 0.000 0.000 N C9orf135 n/a
12 TRCN0000135876 GCATGATGAGAGTGGGATTTA pLKO.1 752 3UTR 100% 13.200 7.920 N C9orf135 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.