Transcript: Human XM_011518439.2

PREDICTED: Homo sapiens folylpolyglutamate synthase (FPGS), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FPGS (2356)
Length:
1922
CDS:
544..1464

Additional Resources:

NCBI RefSeq record:
XM_011518439.2
NBCI Gene record:
FPGS (2356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045928 CCAGTTTGACTATGCCGTCTT pLKO.1 993 CDS 100% 4.050 5.670 N FPGS n/a
2 TRCN0000245001 AGCCCTGCCAGTTTGACTATG pLKO_005 986 CDS 100% 10.800 7.560 N FPGS n/a
3 TRCN0000245000 TTCGAGTCTTGCTCTTCAATG pLKO_005 923 CDS 100% 10.800 7.560 N FPGS n/a
4 TRCN0000245002 AGGGTGGCTGGAGTGAATTAA pLKO_005 1881 3UTR 100% 15.000 9.000 N FPGS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.