Transcript: Human XM_011518441.2

PREDICTED: Homo sapiens RAB GTPase activating protein 1 (RABGAP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RABGAP1 (23637)
Length:
5072
CDS:
207..3416

Additional Resources:

NCBI RefSeq record:
XM_011518441.2
NBCI Gene record:
RABGAP1 (23637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370909 TCCGCGTTTGCTCACCTAATG pLKO_005 1495 CDS 100% 10.800 15.120 N RABGAP1 n/a
2 TRCN0000047339 CCGGGATATTAACCGAACATT pLKO.1 2027 CDS 100% 5.625 7.875 N RABGAP1 n/a
3 TRCN0000370910 AGGGATCAGAAATTCAAATAA pLKO_005 3855 3UTR 100% 15.000 10.500 N RABGAP1 n/a
4 TRCN0000296912 AGCTGTAAGCCGGATACTTTA pLKO_005 968 CDS 100% 13.200 9.240 N RABGAP1 n/a
5 TRCN0000201897 CCGAACACTGAGCTCCATAAA pLKO.1 3359 CDS 100% 13.200 9.240 N Rabgap1 n/a
6 TRCN0000292638 CCGAACACTGAGCTCCATAAA pLKO_005 3359 CDS 100% 13.200 9.240 N Rabgap1 n/a
7 TRCN0000296974 GGTAAGACTACTGATACTAAC pLKO_005 3589 3UTR 100% 10.800 7.560 N RABGAP1 n/a
8 TRCN0000047342 CCCTTGGATTATTAAAGACTT pLKO.1 2485 CDS 100% 4.950 3.465 N RABGAP1 n/a
9 TRCN0000291343 CCCTTGGATTATTAAAGACTT pLKO_005 2485 CDS 100% 4.950 3.465 N RABGAP1 n/a
10 TRCN0000047340 CGAGTGTAAGATACAGGACTT pLKO.1 3278 CDS 100% 4.050 2.835 N RABGAP1 n/a
11 TRCN0000047338 CCAGCCTAAAGGCTGAGTTTA pLKO.1 3704 3UTR 100% 1.320 0.924 N RABGAP1 n/a
12 TRCN0000047341 GCCGAATGTGTCTGAAGGAAT pLKO.1 770 CDS 100% 4.950 2.970 N RABGAP1 n/a
13 TRCN0000307679 GCCGAATGTGTCTGAAGGAAT pLKO_005 770 CDS 100% 4.950 2.970 N RABGAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.