Transcript: Human XM_011518466.2

PREDICTED: Homo sapiens hemicentin 2 (HMCN2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HMCN2 (256158)
Length:
15675
CDS:
138..15245

Additional Resources:

NCBI RefSeq record:
XM_011518466.2
NBCI Gene record:
HMCN2 (256158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056002 GCCCAACATCACCTGGCATAA pLKO.1 10736 CDS 100% 10.800 7.560 N HMCN2 n/a
2 TRCN0000056000 CCCAAGCTCACATGGTTCAAA pLKO.1 7587 CDS 100% 5.625 3.938 N HMCN2 n/a
3 TRCN0000056001 CCGGACATCCACTGGATCAAA pLKO.1 12921 CDS 100% 5.625 3.938 N HMCN2 n/a
4 TRCN0000055998 CCACTCAGAGAAACACTACAA pLKO.1 6608 CDS 100% 4.950 3.465 N HMCN2 n/a
5 TRCN0000179851 CGACTTTCTGTCAACACCAAA pLKO.1 3315 CDS 100% 4.950 3.465 N HMCN2 n/a
6 TRCN0000180063 CTGTGAAGCTCGAAACGTCTT pLKO.1 2720 CDS 100% 4.050 2.835 N HMCN2 n/a
7 TRCN0000055999 CCCAGGTATCGGATAAAGGTT pLKO.1 9442 CDS 100% 3.000 2.100 N HMCN2 n/a
8 TRCN0000178872 CAAACCCAGGATCCATATGAA pLKO.1 3332 CDS 100% 0.000 0.000 N HMCN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.