Transcript: Human XM_011518903.3

PREDICTED: Homo sapiens N(alpha)-acetyltransferase 35, NatC auxiliary subunit (NAA35), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAA35 (60560)
Length:
6810
CDS:
898..2415

Additional Resources:

NCBI RefSeq record:
XM_011518903.3
NBCI Gene record:
NAA35 (60560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135157 CAAACCCAACTTTGTGGTTAT pLKO.1 2298 CDS 100% 10.800 15.120 N NAA35 n/a
2 TRCN0000135714 GACAGTATTTACGTGCCTTTA pLKO.1 518 5UTR 100% 10.800 15.120 N NAA35 n/a
3 TRCN0000135842 CGCATTATGATACAGTACCTT pLKO.1 1729 CDS 100% 3.000 4.200 N NAA35 n/a
4 TRCN0000135379 GATGGATTTCTTGGGTAACAA pLKO.1 2510 3UTR 100% 5.625 3.938 N NAA35 n/a
5 TRCN0000136797 CCATGGAAGAAACTGGTCTTA pLKO.1 2612 3UTR 100% 4.950 3.465 N NAA35 n/a
6 TRCN0000135584 GACAGCCTTATATGACATGAA pLKO.1 2557 3UTR 100% 4.950 3.465 N NAA35 n/a
7 TRCN0000135865 CGAGAATTAAAGTTGGGAGAA pLKO.1 258 5UTR 100% 4.050 2.835 N NAA35 n/a
8 TRCN0000137922 GCATTTGACATGGACGGCAAA pLKO.1 2020 CDS 100% 4.050 2.835 N NAA35 n/a
9 TRCN0000138127 GCTGGCATGATTGGAAACCAA pLKO.1 351 5UTR 100% 3.000 2.100 N NAA35 n/a
10 TRCN0000137333 GTGAGATGGATTTCTTGGGTA pLKO.1 2506 3UTR 100% 2.640 1.584 N NAA35 n/a
11 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 6185 3UTR 100% 4.050 2.025 Y LOC441087 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.