Transcript: Human XM_011518970.3

PREDICTED: Homo sapiens TLE family member 4, transcriptional corepressor (TLE4), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLE4 (7091)
Length:
2232
CDS:
192..2144

Additional Resources:

NCBI RefSeq record:
XM_011518970.3
NBCI Gene record:
TLE4 (7091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158445 CAGTCCCATCTTCCAATTAAA pLKO.1 852 CDS 100% 15.000 10.500 N TLE4 n/a
2 TRCN0000165843 GCAGAACTGAACGCCATCATT pLKO.1 558 CDS 100% 5.625 3.938 N TLE4 n/a
3 TRCN0000275237 GCAGAACTGAACGCCATCATT pLKO_005 558 CDS 100% 5.625 3.938 N TLE4 n/a
4 TRCN0000166665 CCAAAGAGACAGAGACTCCAT pLKO.1 902 CDS 100% 2.640 1.848 N TLE4 n/a
5 TRCN0000275190 CCAAAGAGACAGAGACTCCAT pLKO_005 902 CDS 100% 2.640 1.848 N TLE4 n/a
6 TRCN0000098286 CGGCATTATGTCATGTATTAT pLKO.1 384 CDS 100% 15.000 9.000 N Tle4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.