Transcript: Human XM_011519094.2

PREDICTED: Homo sapiens netrin G2 (NTNG2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NTNG2 (84628)
Length:
5128
CDS:
798..2708

Additional Resources:

NCBI RefSeq record:
XM_011519094.2
NBCI Gene record:
NTNG2 (84628)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141147 CGGCAAGTGCAAGAAGAATTT pLKO.1 1745 CDS 100% 13.200 18.480 N NTNG2 n/a
2 TRCN0000142432 GAACGTCTGCATTGAGTGTAA pLKO.1 2324 CDS 100% 4.950 3.960 N NTNG2 n/a
3 TRCN0000139931 GCCTGCGATTTGGTTTCGTTT pLKO.1 2914 3UTR 100% 4.950 3.960 N NTNG2 n/a
4 TRCN0000145231 GAAACTTCGTTCTGTAGAGAA pLKO.1 3297 3UTR 100% 4.950 3.465 N NTNG2 n/a
5 TRCN0000142293 GATGATGAGAACGTCTGCATT pLKO.1 2316 CDS 100% 4.950 3.465 N NTNG2 n/a
6 TRCN0000141598 CAGCTACATTGACTTCCTGAA pLKO.1 2201 CDS 100% 4.050 2.835 N NTNG2 n/a
7 TRCN0000139586 CATCTCCAACATCGAGGTCAT pLKO.1 1628 CDS 100% 4.050 2.835 N NTNG2 n/a
8 TRCN0000141353 CTGCATTGAGTGTAACTGCAA pLKO.1 2330 CDS 100% 2.640 1.848 N NTNG2 n/a
9 TRCN0000139963 GAATCCCTACCTATGCAGCAA pLKO.1 1013 CDS 100% 2.640 1.848 N NTNG2 n/a
10 TRCN0000141684 GAGTGTAACTGCAACCAGATA pLKO.1 2337 CDS 100% 4.950 2.970 N NTNG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.