Transcript: Human XM_011519465.1

PREDICTED: Homo sapiens interleukin 15 receptor subunit alpha (IL15RA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL15RA (3601)
Length:
2030
CDS:
187..1317

Additional Resources:

NCBI RefSeq record:
XM_011519465.1
NBCI Gene record:
IL15RA (3601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419751 AGCCTCTCTGCTTTAGCTAAA pLKO_005 1357 3UTR 100% 10.800 7.560 N IL15RA n/a
2 TRCN0000437400 ACGCAGACATCTGGGTCAAGA pLKO_005 635 CDS 100% 4.950 3.465 N IL15RA n/a
3 TRCN0000058293 GCAGAGATGAAGACTTGGAAA pLKO.1 1277 CDS 100% 4.950 3.465 N IL15RA n/a
4 TRCN0000058294 GTACATTTGTAACTCTGGTTT pLKO.1 681 CDS 100% 4.950 3.465 N IL15RA n/a
5 TRCN0000058295 GCTACCTCAAGTCAAGGCAAA pLKO.1 1190 CDS 100% 4.050 2.835 N IL15RA n/a
6 TRCN0000058297 GCGGCCACAACAGCAGCTATT pLKO.1 931 CDS 100% 3.600 2.520 N IL15RA n/a
7 TRCN0000058296 CAGCGTTGAAATGGAAGCCAT pLKO.1 1224 CDS 100% 2.640 1.848 N IL15RA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.