Transcript: Human XM_011519932.2

PREDICTED: Homo sapiens dual specificity phosphatase 8 (DUSP8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DUSP8 (1850)
Length:
5500
CDS:
1156..3033

Additional Resources:

NCBI RefSeq record:
XM_011519932.2
NBCI Gene record:
DUSP8 (1850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237858 ATCTATGGATTAGAGGTTTAA pLKO_005 4705 3UTR 100% 13.200 10.560 N DUSP8 n/a
2 TRCN0000237860 GCTCCTTCGTGGAGTACAACA pLKO_005 1253 CDS 100% 4.950 3.960 N DUSP8 n/a
3 TRCN0000237862 CTGGACAAGTCCATCGAGTTC pLKO_005 1828 CDS 100% 4.050 3.240 N DUSP8 n/a
4 TRCN0000237859 TGGAATAAGCTACGTCCTCAA pLKO_005 1710 CDS 100% 4.050 3.240 N DUSP8 n/a
5 TRCN0000378601 GCAGCCAGGCCCGTTATAAAT pLKO_005 3063 3UTR 100% 15.000 10.500 N DUSP8 n/a
6 TRCN0000363115 TAATGCAAAGAAAGGTAAATG pLKO_005 3096 3UTR 100% 13.200 9.240 N DUSP8 n/a
7 TRCN0000237861 CTCGCAGAAGGACGTCCTAAA pLKO_005 1668 CDS 100% 10.800 7.560 N DUSP8 n/a
8 TRCN0000363129 GTCTGGTATTTAAACTGAAAC pLKO_005 3232 3UTR 100% 10.800 7.560 N DUSP8 n/a
9 TRCN0000363109 AGGAAACACTGCTGACCTTTG pLKO_005 3334 3UTR 100% 6.000 4.200 N DUSP8 n/a
10 TRCN0000082782 TCAACGACAACTACTGTGAAA pLKO.1 1793 CDS 100% 4.950 3.465 N DUSP8 n/a
11 TRCN0000082779 CGCCTACATCATGAAGACCAT pLKO.1 1929 CDS 100% 2.640 1.848 N DUSP8 n/a
12 TRCN0000082781 CCGCTCCTTCGTGGAGTACAA pLKO.1 1251 CDS 100% 1.650 1.155 N DUSP8 n/a
13 TRCN0000082780 GCAGGACACTAACCGCCTCAA pLKO.1 2307 CDS 100% 1.350 0.945 N DUSP8 n/a
14 TRCN0000378615 TCATCTGCGAGAGCCGCTTCA pLKO_005 1760 CDS 100% 1.350 0.945 N DUSP8 n/a
15 TRCN0000378679 TGTTCATTCTGGCAATGATTT pLKO_005 3173 3UTR 100% 1.320 0.924 N DUSP8 n/a
16 TRCN0000082778 GCTGTTCATTCTGGCAATGAT pLKO.1 3171 3UTR 100% 0.563 0.394 N DUSP8 n/a
17 TRCN0000378597 CAAGGTGACCATTGCGGAGCT pLKO_005 1341 CDS 100% 0.720 0.432 N DUSP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.