Transcript: Human XM_011520053.2

PREDICTED: Homo sapiens anoctamin 9 (ANO9), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANO9 (338440)
Length:
2967
CDS:
1079..2530

Additional Resources:

NCBI RefSeq record:
XM_011520053.2
NBCI Gene record:
ANO9 (338440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422424 GATACAGGGACTACCGCAATC pLKO_005 2217 CDS 100% 6.000 8.400 N ANO9 n/a
2 TRCN0000168868 CGTGAACTTCGTTGTCATGAA pLKO.1 451 5UTR 100% 4.950 6.930 N ANO9 n/a
3 TRCN0000168347 GAAATGGCACTTCAGCTCATT pLKO.1 1100 CDS 100% 4.950 6.930 N ANO9 n/a
4 TRCN0000173015 CGATTACAACTTCTCCGAGCA pLKO.1 2242 CDS 100% 2.160 3.024 N ANO9 n/a
5 TRCN0000172449 CACCCATTTCTCGTCTCTCAT pLKO.1 1471 CDS 100% 4.950 3.960 N ANO9 n/a
6 TRCN0000423518 ATGGCACTTCAGCTCATTAAC pLKO_005 1103 CDS 100% 13.200 9.240 N ANO9 n/a
7 TRCN0000426948 TGAGCGGATTCTCGCTGTTTG pLKO_005 723 5UTR 100% 10.800 7.560 N ANO9 n/a
8 TRCN0000173061 CAACAGTGTCTTTGGCCTGTA pLKO.1 334 5UTR 100% 4.050 2.835 N ANO9 n/a
9 TRCN0000168791 GCCAGTTGATGAAATCAGGAA pLKO.1 607 5UTR 100% 2.640 1.848 N ANO9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.