Transcript: Human XM_011520068.2

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 18 (GALNT18), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT18 (374378)
Length:
2088
CDS:
529..1821

Additional Resources:

NCBI RefSeq record:
XM_011520068.2
NBCI Gene record:
GALNT18 (374378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036086 GCTGACCGAATATGTGGACAA pLKO.1 609 CDS 100% 4.050 5.670 N GALNT18 n/a
2 TRCN0000036087 CATCCAGAACCGCAAGTCTAA pLKO.1 1683 CDS 100% 4.950 3.465 N GALNT18 n/a
3 TRCN0000036088 CCTGAAGCAATTCCAGTACTA pLKO.1 336 5UTR 100% 4.950 3.465 N GALNT18 n/a
4 TRCN0000036084 CTGCCTCTTTGCTACTGTGTA pLKO.1 1842 3UTR 100% 4.950 3.465 N GALNT18 n/a
5 TRCN0000036085 CCATCCTTTGATAACATCAAA pLKO.1 829 CDS 100% 0.563 0.394 N GALNT18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.