Transcript: Human XM_011520656.3

PREDICTED: Homo sapiens C-type lectin domain family 2 member A (CLEC2A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLEC2A (387836)
Length:
612
CDS:
102..521

Additional Resources:

NCBI RefSeq record:
XM_011520656.3
NBCI Gene record:
CLEC2A (387836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155544 GATGGCTTCATACATCGGATA pLKO.1 135 CDS 100% 4.050 5.670 N CLEC2A n/a
2 TRCN0000156887 GCTAAACCTGTGGCATGTTCA pLKO.1 258 CDS 100% 4.950 3.960 N CLEC2A n/a
3 TRCN0000155360 CAGAAATTGGACAGCCAGTAA pLKO.1 329 CDS 100% 4.950 3.465 N CLEC2A n/a
4 TRCN0000155514 CCTTATGTGCTTCCTGAGTAT pLKO.1 188 CDS 100% 4.950 3.465 N CLEC2A n/a
5 TRCN0000150496 GCTCAGATTGATACACAAGAA pLKO.1 381 CDS 100% 4.950 3.465 N CLEC2A n/a
6 TRCN0000150802 GAGATTCTTGGAAATGGACAA pLKO.1 469 CDS 100% 4.050 2.835 N CLEC2A n/a
7 TRCN0000150509 GATACACAAGAAGACATGGAA pLKO.1 390 CDS 100% 3.000 2.100 N CLEC2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.