Transcript: Human XM_011520853.3

PREDICTED: Homo sapiens sarcospan (SSPN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSPN (8082)
Length:
4356
CDS:
233..655

Additional Resources:

NCBI RefSeq record:
XM_011520853.3
NBCI Gene record:
SSPN (8082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077871 CGAACGGACATGTATTCAATT pLKO.1 259 CDS 100% 13.200 18.480 N SSPN n/a
2 TRCN0000077868 GCCTATTGATACACTTTACTA pLKO.1 2111 3UTR 100% 5.625 3.938 N SSPN n/a
3 TRCN0000077872 TGCTTTGTGATGTGGAAACAT pLKO.1 560 CDS 100% 5.625 3.938 N SSPN n/a
4 TRCN0000077869 GCCTGCTTTGTGATGTGGAAA pLKO.1 557 CDS 100% 4.950 2.970 N SSPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.