Transcript: Human XM_011520913.3

PREDICTED: Homo sapiens tetraspanin 9 (TSPAN9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSPAN9 (10867)
Length:
4207
CDS:
235..762

Additional Resources:

NCBI RefSeq record:
XM_011520913.3
NBCI Gene record:
TSPAN9 (10867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234798 AGATGTGGTTCGATGACAATA pLKO_005 626 CDS 100% 13.200 18.480 N TSPAN9 n/a
2 TRCN0000234799 CATCCACCGGACTGGTAAGAA pLKO_005 729 CDS 100% 5.625 7.875 N TSPAN9 n/a
3 TRCN0000234797 TCCTAGCAGAGCTGATCTTAC pLKO_005 323 CDS 100% 10.800 8.640 N TSPAN9 n/a
4 TRCN0000238799 GTGGGTTGGGTGGCGATTATA pLKO_005 2097 3UTR 100% 15.000 10.500 N TSPAN9 n/a
5 TRCN0000234796 CATTGCCATAGGCACCATTGT pLKO_005 213 5UTR 100% 4.950 3.465 N TSPAN9 n/a
6 TRCN0000119247 CCCAGTTATTTCACAGACATT pLKO.1 1824 3UTR 100% 4.950 3.465 N TSPAN9 n/a
7 TRCN0000119251 GAAGATGTGGTTCGATGACAA pLKO.1 624 CDS 100% 4.950 3.465 N TSPAN9 n/a
8 TRCN0000119248 GCTGATCTTACTCATCCTCTT pLKO.1 333 CDS 100% 4.050 2.835 N TSPAN9 n/a
9 TRCN0000119250 CACTGACTACACAGACTGGTA pLKO.1 492 CDS 100% 2.640 1.848 N TSPAN9 n/a
10 TRCN0000380885 TGGACAAGGTGAACGAGAATG pLKO_005 365 CDS 100% 10.800 7.560 N Tspan9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.