Transcript: Human XM_011521048.2

PREDICTED: Homo sapiens collagen type IV alpha 1 chain (COL4A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL4A1 (1282)
Length:
14378
CDS:
8255..13072

Additional Resources:

NCBI RefSeq record:
XM_011521048.2
NBCI Gene record:
COL4A1 (1282)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420613 ATAGGAATTTGCGTAACTAAC pLKO_005 13197 3UTR 100% 10.800 15.120 N COL4A1 n/a
2 TRCN0000427730 ATTTCGACTTGCGGCTCAAAG pLKO_005 9663 CDS 100% 10.800 15.120 N COL4A1 n/a
3 TRCN0000108418 CCGGGTTCTGTAGGATTGAAA pLKO.1 9788 CDS 100% 5.625 7.875 N COL4A1 n/a
4 TRCN0000108417 CCTGGGATTGATGGAGTTAAA pLKO.1 11837 CDS 100% 13.200 10.560 N COL4A1 n/a
5 TRCN0000108419 CCCTGGCTTGAAAGGTGATAA pLKO.1 10819 CDS 100% 13.200 9.240 N COL4A1 n/a
6 TRCN0000108416 GCCAGGATTTATAGGCGAAAT pLKO.1 9412 CDS 100% 10.800 7.560 N COL4A1 n/a
7 TRCN0000108415 CCCAGAGATAAATGTTTGTTT pLKO.1 13453 3UTR 100% 5.625 3.938 N COL4A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.