Transcript: Human XM_011521238.1

PREDICTED: Homo sapiens phospholipase A2 group IVE (PLA2G4E), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLA2G4E (123745)
Length:
2878
CDS:
847..2325

Additional Resources:

NCBI RefSeq record:
XM_011521238.1
NBCI Gene record:
PLA2G4E (123745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437638 CAGCTACATCACCGGTCTATC pLKO_005 933 CDS 100% 10.800 15.120 N PLA2G4E n/a
2 TRCN0000429303 GGTGAAACTCTCAGAGTATAA pLKO_005 2217 CDS 100% 13.200 9.240 N PLA2G4E n/a
3 TRCN0000420201 GTCCAATTCTTTCCGAGAAAT pLKO_005 1632 CDS 100% 13.200 9.240 N PLA2G4E n/a
4 TRCN0000419186 ACTTGGAGCCTGCTATCTTTG pLKO_005 1010 CDS 100% 10.800 7.560 N PLA2G4E n/a
5 TRCN0000440030 GGCTCGGAGACATGTGGTAAA pLKO_005 1032 CDS 100% 10.800 7.560 N PLA2G4E n/a
6 TRCN0000097215 CCTGAAACAAACCTGTGAGTA pLKO.1 1923 CDS 100% 4.950 3.465 N Pla2g4e n/a
7 TRCN0000152886 GTGGACATTTATGGTCCCAAA pLKO.1 2143 CDS 100% 4.050 2.835 N PLA2G4E n/a
8 TRCN0000156366 CCCTGAAACAAACCTGTGAGT pLKO.1 1922 CDS 100% 2.640 1.848 N PLA2G4E n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 34 5UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 34 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.