Transcript: Human XM_011521314.1

PREDICTED: Homo sapiens aggrecan (ACAN), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACAN (176)
Length:
8726
CDS:
376..7854

Additional Resources:

NCBI RefSeq record:
XM_011521314.1
NBCI Gene record:
ACAN (176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160486 CCAACTATTTCTCAGGAACTA pLKO.1 6517 CDS 100% 4.950 6.930 N ACAN n/a
2 TRCN0000162857 CCATCAACAGAGACCTACGAT pLKO.1 2059 CDS 100% 3.000 4.200 N ACAN n/a
3 TRCN0000163653 GTGAAAGGCATCGTGTTCCAT pLKO.1 823 CDS 100% 3.000 4.200 N ACAN n/a
4 TRCN0000164081 CGTGTTCCATTACAGAGCCAT pLKO.1 834 CDS 100% 2.640 3.696 N ACAN n/a
5 TRCN0000158785 GAACCAACTATTTCTCAGGAA pLKO.1 6514 CDS 100% 2.640 2.112 N ACAN n/a
6 TRCN0000164010 CCATCTGGATTCCCAACTGTT pLKO.1 5332 CDS 100% 4.950 3.465 N ACAN n/a
7 TRCN0000163277 GCAGTGGAACTCCATCTAGTT pLKO.1 6146 CDS 100% 4.950 3.465 N ACAN n/a
8 TRCN0000162135 CCAATGTAAGTGGAGAATCCT pLKO.1 6410 CDS 100% 3.000 2.100 N ACAN n/a
9 TRCN0000164461 CCAACTGTTTCCCTAGTGGAT pLKO.1 5344 CDS 100% 2.640 1.848 N ACAN n/a
10 TRCN0000071732 CTGGATTTAGTGGTGAGTATT pLKO.1 5255 CDS 100% 13.200 7.920 N Acan n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.