Transcript: Human XM_011521333.3

PREDICTED: Homo sapiens GRAM domain containing 2A (GRAMD2A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD2A (196996)
Length:
4085
CDS:
928..1884

Additional Resources:

NCBI RefSeq record:
XM_011521333.3
NBCI Gene record:
GRAMD2A (196996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254955 AGGATATCAAGGTGGTCATTC pLKO_005 1181 CDS 100% 10.800 7.560 N Gramd2 n/a
2 TRCN0000136096 CCAGAAGTATCAGGGAAAGTT pLKO.1 3228 3UTR 100% 5.625 3.938 N GRAMD2A n/a
3 TRCN0000136435 CCTTGCTGAAAGACAGAGATA pLKO.1 3640 3UTR 100% 4.950 3.465 N GRAMD2A n/a
4 TRCN0000135704 GCAAGAAGAGTCTGAGTGTAA pLKO.1 1370 CDS 100% 4.950 3.465 N GRAMD2A n/a
5 TRCN0000135741 CAAGGATATCAAGGTGGTCAT pLKO.1 1179 CDS 100% 4.050 2.835 N GRAMD2A n/a
6 TRCN0000135742 CAAGGTCTTCTTTGTGCTGAT pLKO.1 1758 CDS 100% 4.050 2.835 N GRAMD2A n/a
7 TRCN0000137524 CCCTGAGATGAAGTGGAGAAA pLKO.1 1431 CDS 100% 4.950 2.970 N GRAMD2A n/a
8 TRCN0000133969 CCTGTTTATGACAAACCCAAA pLKO.1 3372 3UTR 100% 4.050 2.430 N GRAMD2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.