Transcript: Human XM_011521369.3

PREDICTED: Homo sapiens bromo adjacent homology domain containing 1 (BAHD1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAHD1 (22893)
Length:
4561
CDS:
112..2454

Additional Resources:

NCBI RefSeq record:
XM_011521369.3
NBCI Gene record:
BAHD1 (22893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425924 ATGAGCCTCCTGTGGTATTAC pLKO_005 2098 CDS 100% 13.200 9.240 N BAHD1 n/a
2 TRCN0000129645 CAATGCTGAAGCTCTCAATAA pLKO.1 477 CDS 100% 13.200 9.240 N BAHD1 n/a
3 TRCN0000436527 CCTTGCAGAATGAAGTGTTTG pLKO_005 2165 CDS 100% 10.800 7.560 N BAHD1 n/a
4 TRCN0000425260 GCATTGAGGAGAAGTGCTATG pLKO_005 2219 CDS 100% 6.000 4.200 N BAHD1 n/a
5 TRCN0000427640 CAAACCTCCCAGCGGTTCTAA pLKO_005 1728 CDS 100% 5.625 3.938 N BAHD1 n/a
6 TRCN0000127907 CAAGGTCAATGGCAAGAACTA pLKO.1 861 CDS 100% 4.950 3.465 N BAHD1 n/a
7 TRCN0000129644 CCCAGAAAGTTAACTGATGAT pLKO.1 3164 3UTR 100% 4.950 3.465 N BAHD1 n/a
8 TRCN0000129912 GCTGGTAGAATTTCAATGGAA pLKO.1 4341 3UTR 100% 3.000 2.100 N BAHD1 n/a
9 TRCN0000130595 CCCACCTGAAATCAAACCAAA pLKO.1 3352 3UTR 100% 4.950 2.970 N BAHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.